regex - output computation in R using shiny -


i trying find pattern of "gc" in different genes(strings) user interface using shiny.i using grep command of r find pattern not able correct output.below code of ui.r

  library(shiny) setwd("c:/users/ishaan/documents/aaa") shinyui(fluidpage(    # copy line below make select box    selectinput("select", label = h3("select human gene sequence"),                choices = list("cd83" = "ugggugauuacauaaucugacaaauaaaaaaaucccgacuuugggaugagugcuaggauguuguaaa"                              , "sec23a" = "uuucacugu"                              , "ankfy1" = "aaguuugacuauauguguaaagggacuaaauauuuuugcaacagcc"                              ,"enst00000250457"="acuuguugaauaaacucagucucc"                              ),                selected = "ugggugauuacauaaucugacaaauaaaaaaaucccgacuuugggaugagugcuaggauguuguaaa"),    hr(),   fluidrow(column(5, verbatimtextoutput("value")),column(5, verbatimtextoutput("value2")))   )) 

server.r

library(shiny) setwd("c:/users/ishaan/documents/aaa") shinyserver(function(input , output) {   strings=input$select    # can access value of widget input$select, e.g.   output$value <- renderprint({ input$select })    output$value2 <- renderprint({ grep("*gc*",input$value })   }) 

as indicated in comments there parenteses missing in code. furthermore statement seems wrong. grep expects regular expression. star doesn't make sense here. instead have use .*. however, means grep match entire string if contains gc guess not result want have.

however can use grepexpr search string gc

 >gregexpr("gc","aagccaagcca")[[1]] [1] 3 8 attr(,"match.length") [1] 2 2 attr(,"usebytes") [1] true 

the output looks bit confusing (to me). can can see string found @ position 3 , 8

the number of occurences given by

length(gregexpr("gc","aagccaagcca")[[1]]) [1] 2 

to make match uppercase strings well

length(gregexpr("gc","gcaagccaagcca",ignore.case=true)[[1]]) 

finally there issue length calculation if there no match. solve issue need use

 mtch <- gregexpr("gcxx","gcaagccaagcxca",ignore.case=true)[[1]]  if(mtch[1]==-1) 0 else length(mtch) 

Comments

Popular posts from this blog

php - XML feed for Wordpress Social Board plugin modifications -

php - Wordpress website dashboard page or post editor content is not showing but front end data is showing properly -

javascript - Twitter Bootstrap - how to add some more margin between tooltip popup and element -